| Human Pseudogenes :: ENSP00000006951.proc.274788 |
| ENSP00000006951.proc.274788 | |
|---|---|
| View | UCSC Genome Browser |
| ID | ENSP00000006951.proc.274788 |
| Chromosome | 2 |
| Start Coordinate | 87646460 |
| Stop Coordinate | 87647697 |
| Strand | - |
| Parent Protein | ENSP00000006951 |
| Protein Sequence Start | 410 |
| Protein Sequence Stop | 410 |
| Parent Gene | ENSG00000007168 |
| Fraction | 1.0 |
| Number of Insertions | 8 |
| Number of Deletions | 2 |
| Number of Shifts | 4 |
| Number of Stops | 1 |
| Identity | 0.877 |
| PolyA | 1 |
| Disablements? | Yes |
| Exons | [[87646460, 87647697]] |
| Introns | [] |
| Pseudogene Class | Processed |
| Pseudogene Sequence | ATGGTGCTGTCCCAGAGACAACGAGATGAACTAAATCAAGCTAAAGCAGATTATCTTCGTTCAAATGGCTACGAAGAGGCATATTCAGTTTTTAAAAAGGAAGCTGAATTAGATATGAATGAAGAAATAAAGTAGGCTGGTGTTTTGGGGAAAAAATGGACATCTGTTATTAGATTACAAAAGAAGTTTATGGAATTAGA |
| Build | 36 |