| Human Pseudogenes :: ENSP00000006951.proc.275486 |
| ENSP00000006951.proc.275486 | |
|---|---|
| View | UCSC Genome Browser |
| ID | ENSP00000006951.proc.275486 |
| Chromosome | 2 |
| Start Coordinate | 111857800 |
| Stop Coordinate | 111859037 |
| Strand | + |
| Parent Protein | ENSP00000006951 |
| Protein Sequence Start | 410 |
| Protein Sequence Stop | 410 |
| Parent Gene | ENSG00000007168 |
| Fraction | 1.0 |
| Number of Insertions | 9 |
| Number of Deletions | 3 |
| Number of Shifts | 5 |
| Number of Stops | 2 |
| Identity | 0.882 |
| PolyA | -- |
| Disablements? | Yes |
| Exons | [[111857800, 111859037]] |
| Introns | [] |
| Pseudogene Class | Processed |
| Pseudogene Sequence | ATGGTGCTGTCCCAGAGACAATGAGATGAACTAAATCAAGCTAAAGCAGATTATCTTCGTTCAAATGGCTACGAAGAGGCATATTCAGTTTTTAAAAAGGAAGCTGAATTAGATATGAATGAAGAAATAAAGTAGGCTGGTGTTTTGGGGGAAAAAATGGACATCTGTTATTAGATTACAAAAGAAGTTTATGGAATTAG |
| Build | 36 |