| Human Pseudogenes :: ENSP00000006951.proc.279609 |
| ENSP00000006951.proc.279609 | |
|---|---|
| View | UCSC Genome Browser |
| ID | ENSP00000006951.proc.279609 |
| Chromosome | 6 |
| Start Coordinate | 64564987 |
| Stop Coordinate | 64565883 |
| Strand | + |
| Parent Protein | ENSP00000006951 |
| Protein Sequence Start | 329 |
| Protein Sequence Stop | 410 |
| Parent Gene | ENSG00000007168 |
| Fraction | 0.8 |
| Number of Insertions | 13 |
| Number of Deletions | 31 |
| Number of Shifts | 10 |
| Number of Stops | 12 |
| Identity | 0.458 |
| PolyA | 3 |
| Disablements? | Yes |
| Exons | [[64564987, 64565883]] |
| Introns | [] |
| Pseudogene Class | Processed |
| Pseudogene Sequence | ATGATTCTGCGACAGAGACACCCAGATGAACCTAATTGAGTTTCAGTTGTCTTTTCAACTGGCTATGAGAGGGTATATTCAGTTTTTAGGAAGAAAGTGAAATTAGATATGAATGAAAAGTTAAATAAGTGTGAAAGGTCTTAGGAAAATTATAGAAGTTTATGCAATTAGAATCAAAACTAAAGTAAAACAAAAAATAT |
| Build | 36 |