| Human Pseudogenes :: ENSP00000009589.frag.273857 |
| ENSP00000009589.frag.273857 | |
|---|---|
| View | UCSC Genome Browser |
| ID | ENSP00000009589.frag.273857 |
| Chromosome | 18 |
| Start Coordinate | 11918835 |
| Stop Coordinate | 11919034 |
| Strand | + |
| Parent Protein | ENSP00000009589 |
| Protein Sequence Start | 72 |
| Protein Sequence Stop | 119 |
| Parent Gene | ENSG00000008988 |
| Fraction | 0.59 |
| Number of Insertions | 3 |
| Number of Deletions | 3 |
| Number of Shifts | 3 |
| Number of Stops | -- |
| Identity | 0.829 |
| PolyA | -- |
| Disablements? | Yes |
| Exons | [[11918835, 11919034]] |
| Introns | [] |
| Pseudogene Class | Ambiguous |
| Pseudogene Sequence | TTTAAAGATACTAAAACACACCCATGGAGCCAGAGGTGCCAATTCACCAATTAGAATCACTCTAAGGAGCAGCAAGGTAAAATCCCTGGAGAAGGTGTGTGCTGACTTGATCAGAGGGGCAAAGGAAAAGAATCTCAAAGTGAAAGGACCAGTTCAAATGCCTACCAAGAATCACTAAAAGAAAAACTCCCTGTGGTGAA |
| Build | 36 |