| Human Pseudogenes :: ENSP00000009589.proc.276120 |
| ENSP00000009589.proc.276120 | |
|---|---|
| View | UCSC Genome Browser |
| ID | ENSP00000009589.proc.276120 |
| Chromosome | 21 |
| Start Coordinate | 36018915 |
| Stop Coordinate | 36019268 |
| Strand | - |
| Parent Protein | ENSP00000009589 |
| Protein Sequence Start | 118 |
| Protein Sequence Stop | 119 |
| Parent Gene | ENSG00000008988 |
| Fraction | 0.99 |
| Number of Insertions | 2 |
| Number of Deletions | -- |
| Number of Shifts | 2 |
| Number of Stops | 2 |
| Identity | 0.797 |
| PolyA | -- |
| Disablements? | Yes |
| Exons | [[36018915, 36019268]] |
| Introns | [] |
| Pseudogene Class | Processed |
| Pseudogene Sequence | ATGGCTTTTAAAGATCCCAGAAAAACACCCATGGAGCTGGAGGTGGTGATTTGCTGAATTCGAATCACGCTAATGAGCTGCCACATAAAATCTCTGGAGAAATGTGTGCTGACTTGAACAGAGGAGCAAAGGAAAAGAATCTCGAAGTGAAAGGACCAGTTAGAATGCCTACCAAGACTTTTGAGAATTACTACAAGAAA |
| Build | 36 |